2026· Journal of Medical Bioscience· Vol 8, pp. 45-53· 0 citations
TL;DR
This study provides a validated CRISPRi workflow for inducible repression of msmeg_6073 in M. smegmatis, suggesting that msmeg_6073 repression may be condition dependent, and improves understanding of the mycobacterial epitranscriptome.
Abstract
Background: Tuberculosis remains a major global health challenge, highlighting the need for new therapeutic targets.Mycobacteria can adapt to environmental stress and antibiotic exposure through a potential mechanism calledepitranscriptomic regulation, mainly RNA methylation.
Objectives: This study investigates msmeg_6073, the Mycobacterium smegmatis ortholog of the essential Mycobacteriumtuberculosis gene rv3579c, predicted to encode a 23S rRNA 22 -O-methyltransferase involved in ribosomal RNA modification.Methods: Using an anhydrotetracycline (ATc)-inducible CRISPR interference (CRISPRi) system, knockdown strains targetingmsmeg_6073 were constructed. Among designed guide RNAs, guide 1 (5’GGGAAGGCCGCGCCTGCGCACACCG 3’)showed the most consistent functional activity. RT-qPCR analysis confirmed transcriptional repression of msmeg_6073under 50 ng/mL ATc induction conditions. Expression analysis of the upstream gene msmeg_6074 ( cysS ) was also conductedto evaluate target specificity. Phenotypic analysis included ATc-inducible drop assays and liquid culture growth curveanalysis.
Results:RT-qPCR analysis confirmed effective transcriptional repression of msmeg_6073 under induced conditions.Furthermore, expression analysis of msmeg_6074 ( cysS) showed no significant transcriptional changes, indicating target-specific repression without upstream gene effects. Phenotypic analysis showed growth inhibition on solid media followingmsmeg_6073 repression, whereas no significant growth defects were observed in liquid culture. These findings suggestthat msmeg_6073 repression may be condition dependent.
Conclusion: This study provides a validated CRISPRi workflow for inducible repression of msmeg_6073 in M. smegmatis.Future RNA methylation and MIC analyses may help clarify the role of msmeg_6073 in ribosome-associated processes andsusceptibility to ribosome-targeting antibiotics, improving understanding of the mycobacterial epitranscriptome and itspotential relevance to future therapeutic strategies.
Background: Tuberculosis remains a major global health threat, exacerbated by the increasing prevalence of drugresistant strains. The RNA methyltransferase mraW is predicted to play an important regulator of bacterial gene expression and cellular physiology. However, its function in mycobacteria remains unclear.
Objective: This study aims to characterize the function of the mraW RNA methyltransferase in Mycobacterium smegmatis using a CRISPR interference (CRISPRi)-mediated gene knockdown.
Methods: A mraW-targeting sgRNA was constructed and expressed in M. smegmatis mc²155, and knockdown effect was induced using anhydrotetracycline (ATc). Knockdown efficiency was confirmed by RT-qPCR, which showed approximately 55% reduction in mraW transcript levels.
Results: Phenotypic analysis revealed that mraW knockdown resulted in ATc concentration-dependent growth inhibition, reduced colony formation, and decreased bacterial viability in both solid and liquid culture conditions. Consistent with the inducible nature of the CRISPRi system, stronger growth defects were observed at higher ATc concentrations, suggesting increased repression of mraW, while pLJR962 vector controls remained unaffected, confirming that the observed effects were specifically associated with mraW knockdown. These findings demonstrate that mraW is important for optimal growth
and survival in M. smegmatis, supporting a role for RNA methyltransferases in essential mycobacterial physiological processes.
Conclusion: This study further highlights the utility of CRISPRi for functional characterization of essential genes in mycobacteria and suggests that RNA methylation pathways may represent novel potential targets for future anti-tuberculosis strategies.
Nitid Santikul, Suwatchareeporn Rotcheewaphan, Pornchai Kaewsapsak· Journal of Medical Bioscienc...· 0 citations
Findings indicate that LmRab11A functions as an important regulatory factor influencing gene expression, metabolic homeostasis, and developmental processes in Locusta migratoria, thereby contributing to normal growth and molting.
Mureed Abbas, Yiyan Zhao, A. Basit et al.· Insects· 0 citations
Introduction Tuberculosis (TB), caused by Mycobacterium tuberculosis, remains a major global health challenge, particularly due to the increasing emergence of multidrug-resistant strains and limited treatment options. Bacteriophages have gained attention as potential alternatives or adjuncts to conventional antibiotics owing to their host specificity and antibacterial efficacy. Methods This study reports the isolation and detailed characterization of mycobacteriophage Kashi_RDG1 (KRDG1), isolated using Mycobacterium smegmatis mc2155. Genomic analysis, transmission electron microscopy, host range analysis, one-step growth assay, adsorption assay, multiplicity of infection (MOI) determination, and infection kinetics were performed to characterize the phage. Results Genomic analysis identified KRDG1 as sub cluster K1 mycobacteriophage, with a genome size of 58,681 bp containing 95 predicted open reading frames (ORFs), of which 39 are functionally annotated. Transmission electron microscopy analysis confirmed its siphovirus-like morphology while host range analysis depicted its polyvalent activity against Mycobacterium fortuitum (opportunistic pathogen) and M. tuberculosis H37Ra (an attenuated Mtb strain) in addition to M. smegmatis. One-step growth analysis revealed latent period of 80 min and burst size of 100 phage/bacterial cell supporting its efficient infection dynamics. Notably, infection kinetics demonstrated strong host bacterial killing during the logarithmic phase. Discussion While KRDG1 exhibits temperate characteristics, its close genomic similarity to previously engineered therapeutic phage (ZoeJ) highlights its potential for future genetic engineering and therapeutic exploration against pathogenic mycobacterial and non-mycobacterial infections.
Anuja Kakkar, Garima Kandwal, Tanmayee Nayak et al.· Frontiers in Microbiology· 0 citations
Background: The bean flower thrips, Megalurothrips usitatus, is a destructive agricultural pest with increasing resistance to pyrethroid insecticides. Most mechanistic studies emphasize mutations in the pore-forming voltage-gated sodium channels α-subunit, whereas the contribution of insect-specific sodium-channel auxiliary subunits remains unclear. Methods: We used dsRNA feeding, pyrethroid bioassays, RNA sequencing, and RT-qPCR validation to evaluate the role of temperature-induced paralytic E (TipE) in M. usitatus. Results: The optimized RNAi condition was 400 μg/mL of dsTipE for 48 h, which reduced TipE expression by 32.55%. TipE knockdown increased adult mortality after exposure to λ-cyhalothrin and permethrin, indicating increased pyrethroid-associated susceptibility under laboratory conditions. Transcriptome sequencing identified 205 differentially expressed genes, with enrichment in metabolism-related pathways. RT-qPCR confirmed reduced expression of CYP307a1, an ecdysteroid-biosynthesis-related P450 gene, and SCD, a lipid-metabolism gene, while Nav α-subunit transcript abundance did not change significantly. Conclusions: These results identify TipE as an auxiliary-subunit factor associated with pyrethroid susceptibility in M. usitatus and provide a transcriptome-based working model linking sodium-channel auxiliary regulation with endocrine- and lipid-metabolism-related responses. This study expands the candidate space for pyrethroid resistance research beyond Nav α-subunit mutations, although the causal roles of CYP307a1 and SCD require further validation.
Abstract Neisseria meningitidis is a human-adapted commensal pathogen that must continuously balance nutrient acquisition with stress tolerance. Here, we identify a type II-C CRISPR/Cas-associated small RNA (scaRNA) as a posttranscriptional regulator of the efeUOB operon and oxidative stress responses. Using in vitro RNA binding and structure probing assays, we show that the scaRNA interacts with the 5′ untranslated region of efeO mRNA, leading to reduced translation of this component of the ferrous iron transporter EfeUOB. Consistent with this, efeO translational fusions demonstrate repression by the scaRNA, whereas a ΔscaRNA mutant shows increased reporter expression. We further show that meningococcal Cas9 (Nme1Cas9) is able to cleave scaRNA in vitro, but in vivo phenotypes are primarily scaRNA-dependent, indicating that Nme1Cas9 contributes, at most, indirectly to this regulation. In line with this observation, comparative proteomics revealed overlapping but distinct roles of scaRNA and Nme1Cas9 in oxidative stress adaptation, energy metabolism, and ion transport. While steady-state protein abundances did not capture all scaRNA-dependent effects, functional assays confirmed that scaRNA inactivation reduces survival under oxidative stress. Together, our results identify scaRNA-mediated repression of efeO as a novel posttranscriptional mechanism that contributes to stress adaptation in meningococci. These findings expand the functional repertoire of CRISPR-associated elements and suggest a role for small RNA-based regulation in iron-related stress adaptation in a major human pathogen.
Denise Pytlik, Milan Gerovac, Thorsten Bischler et al.· microLife· 0 citations
A critical molecular checkpoint is discovered that acts as a physical anchor, linking the bacterial chromosome to the cell envelope to ensure that chromosome replication is synchronized with cell division, and a single mutation in the replication machinery can fully bypass the loss of this anchor.
Courtney Dover, Kipa Tamrakar, Bikash Dwivedi et al.· bioRxiv· 0 citations