Skip to content

HNRNPF-driven retention of exon 14 in HIF1A pre-mRNA promotes breast cancer metastasis.

Jul 2026 · Biochimica et Biophysica Acta - Molecular Basis of Disease · Vol 1872, pp. 168379 · 0 citations · 49 references
Medicine

TL;DR

The HNRNPF/HIF1A-L/CXCR4/AKT axis as a central regulatory circuit controlling breast cancer metastasis is elucidated and it is suggested that correcting the aberrant splicing of HIF1A may represent a novel therapeutic strategy for cancer.

Abstract

Hypoxia-inducible factor 1-alpha (HIF1A) is a core regulator of cellular adaptation to hypoxic environments and is extensively involved in various cancer processes. Although it is known that HIF1A produces two isoforms, HIF1A-L and HIF1A-S, through the alternative splicing of exon 14, the specific functional differences between these isoforms in cancer development and progression remain unclear, and the molecular mechanisms regulating this exon skipping event have yet to be elucidated. Clinical IHC and FISH analyses demonstrate that HIF1A-L expression is elevated in high-grade breast cancer tissues and correlates with malignant progression. Using transcriptomics and functional assays, we demonstrate that HIF1A-L enhances, while HIF1A-S inhibits, cancer cell proliferation, migration, and invasion. Mechanistically, through luciferase reporter and Western blot analyses, we found that HIF1A-L upregulates CXCR4 to activate the AKT pathway, whereas HIF1A-S antagonizes this axis. Furthermore, via CL-RIP, MS2-RIP, and RNA-pull down assays, we identify the RNA-binding protein HNRNPF as the key upstream regulator that specifically binds to a conserved G-rich sequence (gggaggtggaggttgcgatgagctgagatcagg) within intron 13 of HIF1A pre-mRNA to promote exon 14 retention and HIF1A-L production. Critically, in vivo metastasis assays in nude mice reveal that knockdown of HNRNPF or HIF1A-L suppresses lung metastasis, along with reduced CXCR4 in lung tissues and lower serum levels of the pro-metastatic cytokines IL-6 and CXCL12, whereas knockdown of HIF1A-S exacerbates metastasis. This study elucidates the HNRNPF/HIF1A-L/CXCR4/AKT axis as a central regulatory circuit controlling breast cancer metastasis and suggests that correcting the aberrant splicing of HIF1A may represent a novel therapeutic strategy for cancer.

View source

Similar papers

Open access Aug 2026

A dual role for miR-210-3p in hypoxia-driven signaling and mitotic regulation in cancer

miR-210-3p is a well-established hypoxia-induced microRNA that is commonly upregulated in a wide range of solid tumors, traditionally linked to mitochondrial repression and hypoxia-inducible factor (HIF) signaling. However, its functional role in cancer remains complex and highly context dependent. Here we perform a comprehensive pan-cancer transcriptomic analysis together with functional assays, revealing that miR-210-3p not only mediates classical hypoxic responses but also amplifies mitotic gene expression through activation of FOXM1. Mechanistically, this effect is shown to be dependent on HIF1α but not on HIF2α and, importantly, it has not been recapitulated by hypoxia alone. Notably, activation of the mitotic program is observed in breast cancer cells but not in head and neck squamous carcinoma models, highlighting a strong degree of context dependency across tumor types. In breast cancer cells, miR-210-3p overexpression enhances FOXM1 phosphorylation, upregulates kinetochore regulators, and induces mitotic defects, correlating with poor prognosis in aggressive tumors. Together, these findings position miR-210-3p as a molecular integrator linking pseudohypoxia to mitotic dysregulation, contributing to tumor aggressiveness by sustaining HIF activity and promoting mitotic stress. This dual functionality reconciles its paradoxical effects on proliferation and highlights its potential as a therapeutic target in cancers characterized by pseudohypoxia and mitotic abnormalities.

Jaime San-Juan-Guardado, María Turienzo-Durán, Álvaro Suárez-Priede et al. · 0 citations
Aug 2026

Circ_PRKCA Drove NSCLC Progression via SRSF1/HIF-1A/PKM2 Axis-Mediated Glycolytic Reprogramming.

Elucidating the complex molecular drivers of non-small cell lung cancer (NSCLC) and identifying novel therapeutic targets are urgently needed. Although circPRKCA is implicated in tumorigenesis, its role in NSCLC remains poorly characterized. This study investigates the biological functions and regulatory mechanisms of circPRKCA in NSCLC. CircPRKCA expression and downstream target expression were assessed via qRT-PCR and Western blotting. In vitro functional assays evaluated circPRKCA's role in NSCLC cells. Regulatory mechanisms were further examined using database analysis, RNA immunoprecipitation (RIP), and dual-luciferase reporter assays. In vivo tumor growth was evaluated in mouse xenograft models. CircPRKCA was significantly upregulated in NSCLC and promoted tumor growth and metastasis. Our data suggest that circPRKCA may act as a scaffold for RNA-binding proteins (RBPs), potentially facilitating the recruitment of SRSF1 to HIF-1A mRNA, which appeared to correlate with increased HIF-1A stability. HIF-1A overexpression enhanced NSCLC cell proliferation via PKM2-mediated glycolysis. High circPRKCA expression correlated with poor survival in NSCLC patients. CircPRKCA-SRSF1 axis enhanced proliferation and suppressed apoptosis by stabilizing HIF-1A and modulating PKM2-driven glycolysis. These findings reveal novel diagnostic biomarkers and therapeutic strategies for NSCLC.

Hai-Ting Chen, Xingxing Jin, Leilei Tao et al. · 0 citations
Open access Jul 2026

Lysyl oxidase drives ccRCC progression by coordinating HIF-2α transcription program with tumor microenvironment

Clear cell renal cell carcinoma (ccRCC) is driven by persistent HIF-2α transcription program initiated by VHL loss, yet molecular mediators sustaining this program are poorly defined. Using single-cell transcriptomics, we identified lysyl oxidase (LOX) as a driver of ccRCC progression, selectively enriched in a hypoxia/epithelial-mesenchymal transition (EMT) gene program associated with poor outcome. While LOX oxidizes and stabilizes HIF-2α by antagonizing HUWE1-mediated ubiquitination and degradation, thereby sustaining HIF-2α-driven transcription in cancer cells, it also remodels extracellular matrix (ECM) and promotes angiogenesis in the tumor microenvironment (TME). Genetic or pharmacological inhibition of LOX destabilizes HIF-2α, disrupts ECM, inhibits angiogenesis, and suppresses tumor initiation, growth, and metastasis in vivo. LOX inhibition enhances anti-angiogenic therapy response and remains effective in belzutifan-resistant HIF-2α G323E-mutant tumors. Nuclear LOX protein correlates with nuclear HIF-2α in high-grade patient tumors. Together, LOX coordinates HIF-2α transcription program with TME and is a therapeutic target in ccRCC.

B. Ulukan, O. Saatci, A. Madrigal et al. · 0 citations
Aug 2026

HIF-1α-mediated regulation of ATG7 and KDM5C in ferroptosis.

Hypoxia, a hallmark of the solid tumor microenvironment (TME), drives malignant progression and confers therapy resistance. In liver cancer, the hypoxia-inducible factor-1α (HIF-1α) has been implicated in suppressing ferroptosis, a key mechanism of therapy resistance; however, its precise regulatory network remains elusive. To systematically identify novel mediators within the HIF-1α-ferroptosis axis, we integrated bioinformatic analyses of The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO) datasets with experimental validation in hypoxic cells. This strategy identified ATG7 and KDM5C as core hypoxia-responsive genes. ATG7, a key autophagy regulator, also maintains iron homeostasis and modulates oxidative stress, while the histone demethylase KDM5C regulates metabolic and antioxidant gene expression. To functionally dissect their roles, we engineered a novel dual-fluorescence reporter system in HepG2 cells. This system utilizes a synthetic HIF-1α responsive promoter, comprising five tandem repeats of the hypoxia response element (HRE), to drive EGFP expression, thereby reporting hypoxic signaling. Concurrently, the activity of the ATG7 or KDM5C promoter is reported by miRFP670. The resulting cell lines (HepG2-ATG7p-miRFP670-5HRE-EGFP and HepG2-KDM5Cp-miRFP670-5HRE-EGFP) thus visually couple promoter activity with the HIF-1α-mediated hypoxic response. Our work provides a powerful visualizable platform to dynamically study the crosstalk between HIF-1α and ferroptosis in liver cancer, facilitating the exploration of hypoxia-ferroptosis interplay in hepatocarcinogenesis and therapeutic response.

Kuo-Ye Tian, Peng Chang, Xiaoyu Yang et al. · 0 citations
Open access Jul 2026

MORC2 controls HIF-1α stability via an HDAC4-dependent mechanism to regulate erythropoiesis.

The hypoxia-inducible factor (HIF) signaling pathway is essential for cellular adaptation to low oxygen. Although the canonical PHD-pVHL pathway that mediates HIF-α degradation under normoxia is well established, alternative regulatory mechanisms remain poorly understood. Here, we identify Microrchidia family CW-type zinc-finger 2 (MORC2) as a negative regulator of HIF-α. In zebrafish, CRISPR/Cas9-generated morc2 mutants developed polycythemia, systemic hypoxia, and constitutive activation of the HIF pathway. Mechanistically, MORC2 counteracts histone deacetylase 4 (HDAC4) by competing for HIF-1α binding. Loss of MORC2 enhances HDAC4 recruitment to HIF-1α, reducing acetylation at lysine 629 and preventing proteasomal degradation of HIF-1α. These results define a regulatory mechanism in which MORC2 modulates HIF-1α stability via HDAC4 mediated deacetylation, shedding light on hematopoiesis and HIF-related disorders.

Yanfei Tang, Boqi Zhang, Ting-ting Xue et al. · 0 citations
Open access Jul 2026

Splicing-mediated control of hnRNPD isoform switching by SRSF2 drives PD-L1-dependent immune evasion in gallbladder cancer

A specific protein (SRSF2) acts like a rogue editor, altering the genetic instructions of another molecule (hnRNPD) and creates a “shield” (PD-L1) on the surface of the cancer cell, effectively blinding the immune system and allowing the tumor to grow unchecked.

Zhao Cheng, Lin Jiang, Ming-yang Wang et al. · 0 citations